February 13, 2024

For over 50 years, the legendary Yeast Genetics & Genomics course has been taught each summer at Cold Spring Harbor Laboratory, though the name didn’t include “Genomics” in the beginning. The list of people who have taken the course reads like a Who’s Who of yeast research, including Nobel laureates and many of today’s leading scientists.
The application deadline is March 31st, so don’t miss your chance!
Find all the details and application form at the CSHL Meetings & Courses site. This year’s instructors – Grant Brown, Soni Lacefield, and Greg Lang – have designed a course (July 23 – August 13) that provides a comprehensive education in all things yeast, from classical genetics through up-to-the-minute genomics. Students will perform and interpret experiments, learning about things like:
Techniques have been summarized in the accompanying course manual, published by CSHL Press.

Who should attend? Scientists who aren’t part of large, well-known yeast labs are especially encouraged to apply – for example, professors and instructors who want to incorporate yeast into their undergraduate genetics classrooms; scientists who want to transition from mathematical, computational, or engineering disciplines into bench science; and researchers from small labs or institutions where it would otherwise be difficult to learn the fundamentals of yeast genetics and genomics.
What else goes on there? Besides its scientific content, the fun and camaraderie at the course is also legendary. In between all the hard work there are late-night chats at the bar and swimming at the beach. There’s a fierce competition between students at the various CSHL courses in the Plate Race, which is a relay in which teams have to carry stacks of 40 Petri dishes (used, of course). There’s also typically a sailboat trip, a microscopy contest, and a mysterious “Dr. Evil” lab!
The Yeast Genetics & Genomics Course is loads of fun – don’t miss out!
Categories: Conferences
December 13, 2023
About this newsletter:
This is the December 2023 issue of the SGD newsletter. The goal of this newsletter is to inform our users about new features in SGD and to foster communication within the yeast community. You can view this newsletter, as well as previous newsletters, on the SGD Community Wiki.
The S. cerevisiae strain S288C reference genome annotation was updated. The new genome annotation is release R64.4.1, dated 2023-08-23. Note that the underlying genome sequence itself was not altered in any way.
This annotation update included:
new uORFs for 3 ORFs:
8 new ncRNAs:
3 ORFs demoted from ‘Uncharacterized’ to ‘Dubious’ based on request from NCBI because they overlap tRNAs:
Various sequence and annotation files are available on SGD’s Downloads site. You can find more update details on the Details of 2023 Reference Genome Annotation Update R64.4 SGD Wiki page.

SGD’s instance of Textpresso has recently been updated! Each week, SGD biocurators triage new publications from PubMed to load the newest yeast papers into the database. Once they are in SGD, those papers get indexed and loaded into Textpresso – a tool for full-text mining and searching.
This is the new part: Content updates in SGD’s Textpresso are now happening on a weekly basis, meaning you can search full text of the very latest yeast papers!
You already love Textpresso for searching full text and its other bells and whistles:
Textpresso can be accessed via the “Full-text Search” link under “Literature” in the purple toolbar that runs across the top of most SGD webpages. Now you can search full text of the very latest yeast papers each week!

YeastPathways, which is the database of metabolic pathways and enzymes in the budding yeast Saccharomyces cerevisiae, is manually curated and maintained by the curation team at SGD.
This resource is jam-packed with information, but somewhat hidden from view. To make the pathways more readily accessible, some time ago we added a new section with pathways links on the relevant gene pages. Now the pathways are available in SGD Search!
The category “Biochemical Pathways” is now available, with facets (i.e., subcategories) for References and Loci. For even easier access, we also added the Pathway names and IDs to the autocomplete in the Search box, to enable quick browsing. Enjoy!

microPublication Biology is part of the emerging genre of rapidly-published research communications. We are seeing a strong set of microPublications come through the database and are glad for this venue to publish brief, novel findings, negative and/or reproduced results, and results which may initially lack a broader scientific narrative. Each article is peer-reviewed, assigned a DOI, and indexed through PubMed and PubMedCentral.
Consider microPubublications when you have a result that doesn’t necessarily fit into a larger story, but will be of value to others.
Latest yeast microPublications:
All yeast microPublications can be found in SGD.

YeastMine is SGD’s data warehouse, powered by InterMine. We have so many templates (i.e., pre-defined queries) that provide access to so many different kinds of data.
A big area of focus for SGD and the yeast community is alleles. Alleles are different versions of genes that vary in DNA and sometimes protein sequence. Did you know that you can easily and quickly get all curated yeast allele data directly from YeastMine?
The Genes -> Alleles template returns data for one gene or a list of genes or the entire genome! Data include standard and systematic names for genes, gene name descriptions, allele names and descriptions, allele types, aliases, and references. SGDIDs for genes are included, and now SGDIDs for the alleles have been added. Previously, this query returned all of these data without the SGDIDs for the alleles. Based on user feedback, we have now made these allele SGDIDs available, so that they can be used to identify and distinguish different alleles.
Back in the day, SGD maintained an FTP site to distribute data in various files. More recently, you have found these files in the SGD Downloads site. We have now moved these files to YeastMine:
From the YeastMine homepage, click Templates at top left. In the Filter, select ‘Downloads’ to constrain the list of templates.
The following query templates are listed under Downloads:
For help using YeastMine, please see the SGD Help Pages and our YeastMine playlist on the SGD YouTube Channel.

SGD curators use the Chemical Entities of Biological Interest (ChEBI) Ontology, maintained by EMBL-EBI, to describe chemicals used in experiments curated from yeast publications and displayed on SGD webpages.
You may have noticed that we have recently added chemical structures provided by ChEBI to the Chemical pages in SGD! Click the structure to zoom in, click again to zoom back out.
It’s a small detail, but we love this feature, and hope that you do too! Thanks, ChEBI!

The Alliance of Genome Resources, a collaborative effort between SGD and other model organism databases (MOD), released version 6.0 in September 2023.
Version 6.0 adds new features to gene pages:

Discourse, Mastodon, BlueSky – oh my! Social media is in a chaotic period, with once tight-knit communities having been dismantled and thrown into the ether. SGD feels your pain; we have been searching for our audience, waiting for the stardust to settle, coagulate, coalesce…. In the interim, in an effort to reach you, we have set up SGD outposts on various platforms:
Discourse: The Alliance of Genome Resources Community Forum brings together communities of the major model organisms – yeast, worm, fly, zebrafish, frog, rat, and mouse – in one place. Users can create accounts to post announcements and questions, and chat with other researchers in a science-focused arena. Contact SGD for an invited account, which has additional permissions.
Mastodon: We’re just getting started with Mastodon; follow SGD at @yeastgenome@genomic.social
BlueSky: We’ve also just begun with BlueSky; follow SGD at @yeastgenome.bsky.social
We will be cross-posting to the various accounts – come find SGD on these platforms and we can navigate this latest social media adventure together!

We want to take this opportunity to wish you and your family, friends and lab mates the best during the upcoming holidays. Stanford University will be closed for two weeks starting December 21, reopening on January 4th, 2024. Although SGD staff members will be taking time off, the website will be up and running throughout the winter break, and we will resume responding to user requests and questions in the new year.
Note: If you no longer wish to receive this newsletter, please contact the SGD Help Desk at sgd-helpdesk@lists.stanford.edu.
Categories: Newsletter
Tags: Newsletter
December 06, 2023
SGD’s instance of Textpresso has recently been updated! Each week, SGD biocurators triage new publications from PubMed to load the newest yeast papers into the database. Once they are in SGD, those papers get indexed and loaded into Textpresso – a tool for full-text mining and searching. This is the new part: Content updates in SGD’s Textpresso are now happening on a weekly basis, meaning you can search full text of the very latest yeast papers!

You already love Textpresso for searching full text and its other bells and whistles:

Textpresso can be accessed via the “Full-text Search” link under “Literature” in the purple toolbar that runs across the top of most SGD webpages. Now you can search full text of the very latest yeast papers each week!
Categories: Announcements
November 27, 2023
Gene transcription is facilitated by RNA polymerase enzyme complexes that collaborate with transcription factors, repressors, chromatin remodelers, and other cellular factors. RNA Polymerase III (RNAPIII) mainly transcribes short DNA fragments called tDNAs, that code for transfer-RNAs (tRNAs). In repressive conditions, tDNA transcription is repressed by the well-characterized protein Maf1. A new study by Van Breugel et al., recently published in Molecular Cell, identified Fpt1p (YKR011C) as an additional regulator of RNAPIII in S. cerevisiae.
By using Epi-Decoder, a technique based on synthetic genetic array (SGA), chromatin immunoprecipitation and DNA-barcode sequencing, the local chromatin-proteome of a single tDNA was decoded in active and repressive conditions. The authors found major reprogramming of the core RNAPIII transcription machinery and other known chromatin-binding proteins. Surprisingly, they found the protein Ykr011c to be enriched in the tDNA chromatin-proteome, especially under repressive conditions, prompting the authors to rename the gene FPT1 (Factor in the Proteome of tDNAs number 1).

Following up on the Epi-Decoder finding, genome-wide sequencing methods such as ChIP-seq and ChIP-exo revealed that Fpt1p uniquely binds RNAPIII-regulated genes. Using the anchor away system to conditionally deplete core RNAPIII transcription factors from the nucleus, Fpt1 binding to tRNA genes was found to require both TFIIIB and TFIIIC but not RNAPIII or ongoing transcription. tRNA genes have been described to differentially respond to repressive signals but gene-specific regulatory mechanisms have largely remained elusive. Looking at Fpt1p, Van Breugel et al. found a correlation between tDNA responsiveness to repressive signals and Fpt1p occupancy, suggesting a negative regulatory role for Fpt1p. Substantiating these results, FPT1 knockout strains showed increased occupancy of RNAPIII and TFIIIB at tRNA genes, while TFIIIC occupancy decreased. These outcomes point towards a role for Fpt1p in promoting eviction of RNAPIII upon repressive signals.
In summary, taking advantage of multiple yeast genetic approaches, Van Breugel et al. found that the previously uncharacterized protein Fpt1 is a bona fide RNAPIII regulator in S. cerevisiae. Their research emphasizes the importance of not overlooking uncharacterized proteins, as they may possess alternative regulatory roles that could change our views on fundamental cellular processes.
Text and image provided by Marlize van Breugel, MSc.
Categories: News and Views
Tags: RNA polymerase III, Saccharomyces cerevisiae
October 03, 2023
Members of the yeast community come to SGD to find the latest peer-reviewed budding yeast-specific scientific literature. You could go to Google or PubMed and find huge piles of literature…but then you’d have to slog through the lists and pages to find exactly what you’re looking for. Instead, you skip all that and come straight to SGD, knowing that SGD biocurators do all this vetting for you.
Each Friday night, we cast a wide net, scraping PubMed for any and all new papers, using keywords ‘yeast’ or ‘cerevisiae’. We do this broad search so that we don’t miss anything, but precisely because the search is so broad, we inevitably catch some papers that we end up throwing back. For the papers we keep each week, SGD biocurators “triage” them to attach genes, alleles, protein complexes, and biochemical pathways, and to identify papers that warrant further attention because they contain curatable phenotypes, functional annotations, regulatory relationships, post-translational modifications, disease associations, or large-scale datasets, etc.

SGD lists all the new papers on the ‘Literature Recently Added to SGD‘ page, with the newest papers added each day at the very top. This page includes all papers added to SGD within the past 30 days. In the past this page has just listed the papers. We recently made it more useful by adding the list of attached genes, alleles, protein complexes, and biochemical pathways (the ‘entities’) for each paper. Now you can search (i.e., ‘find in page’, ⌘+F, Ctrl+F) for your favorite gene(s) each week to see if any new papers have made it into SGD, so that you stay updated on research related to your area of study.
Access the ‘Literature Recently Added to SGD‘ page via the ‘New Yeast Papers‘ link in the Literature pull-down menu in the purple toolbar running across the top of most SGD webpages.

If you have a paper that should be in SGD but isn’t, please let us know so we can add it! Just shoot us an email, or use SGD’s Submit Data form (found in the Community pull-down menu in the purple toolbar running across the top of most SGD webpages).
Categories: Announcements, Website changes
September 28, 2023
YeastMine is SGD’s data warehouse, powered by InterMine. We have so many templates (i.e., pre-defined queries) that provide access to so many different kinds of data!
A big area of focus for SGD and the yeast community is alleles. Alleles are different versions of genes that vary in DNA and sometimes protein sequence. Did you know that you can easily and quickly get all curated yeast allele data directly from YeastMine?
From the YeastMine home page, click ‘Templates‘ at top left. From there, filter for ‘allele’.

The Genes -> Alleles template returns data for one gene or a list of genes or the entire genome! Data include standard and systematic names for genes, gene name descriptions, allele names and descriptions, allele types, aliases, and references. SGDIDs for genes are included, and now SGDIDs for the alleles have been added. Previously, this query returned all of these data without the SGDIDs for the alleles. Based on user feedback, we have now made these allele SGDIDs available, so that they can be used to identify and distinguish different alleles. Enjoy!

There are thousands of alleles in SGD! Give the YeastMine Genes -> Alleles template a whirl! Get all the alleles for your favorite gene or list of genes.
For help using YeastMine, please see the SGD Help Pages and YouTube Channel.
Categories: Data updates, Website changes
September 20, 2023
Back in the day, SGD maintained an FTP site to distribute data in various files. More recently, you have found these files in the SGD Downloads site. We have now moved these files to YeastMine:

From the YeastMine homepage, click Templates at top left. In the Filter, select ‘Downloads’ to constrain the list of templates.
The following templates are listed under Downloads:
• Deleted Merged Features: Retrieve all deleted and merged features.
• Retrieve Functional Complementation for genes: For gene(s), retrieve information about cross-species functional complementation between yeast and another species.
• Retrieve GO Terms: Retrieve GO Terms, including name, ID, namespace, and definition.
• Retrieve SGD chromosomal Features: Retrieve genes and other chromosomal features, including IDs, coordinates, and descriptions.
• Retrieve all cross-references for all genes: Retrieve IDs for yeast gene and gene products in other databases.
• Retrieve all domains of all genes: Retrieve Proteins/Genes that have a given domain.
• Retrieve all interactions for all genes: Retrieve physical and genetic interactions for all genes.
• Retrieve all pathways for all genes: Retrieve all metabolic pathways for all genes.
• Retrieve protein properties of all proteins of ORFs: Retrieve protein properties, including pI, molecular weight, N-terminal and C-terminal sequences, codon bias, etc. of all proteins.
For help using YeastMine, please see the SGD Help Pages and YouTube Channel.
Categories: Data updates, Tutorial, Website changes
September 14, 2023
SGD curators use the Chemical Entities of Biological Interest (ChEBI) Ontology, maintained by EMBL-EBI, to describe chemicals used in experiments curated from yeast publications and displayed on SGD webpages.
You may have noticed that we have recently added chemical structures provided by ChEBI to the Chemical pages in SGD!

Click the structure to zoom in, click again to zoom back out.

It’s a small detail, but we love this feature, and hope that you do too! Thanks, ChEBI!
Categories: Website changes
Tags: chemicals, phenotypes
September 13, 2023
YeastPathways, which is the database of metabolic pathways and enzymes in the budding yeast Saccharomyces cerevisiae, is manually curated and maintained by the curation team at SGD.
This resource is jam-packed with information, but somewhat hidden from view. To make the pathways more readily accessible, some time ago we added a new section with pathways links on the relevant gene pages. Now the pathways are available in SGD Search!

The category “Biochemical Pathways” is now available, with facets (i.e., subcategories) for References and Loci.

For even easier access, we also added the Pathway names and IDs to the autocomplete in the Search box, to enable quick browsing. Enjoy!

Categories: Website changes
September 08, 2023
The S. cerevisiae strain S288C reference genome annotation was updated. The new genome annotation is release R64.4.1, dated 2023-08-23. Note that the underlying genome sequence itself was not altered in any way.
This annotation update included:
| Chr | Feature | Description of change | Reference |
|---|---|---|---|
| III | SUT035/YNCC0015W | New ncRNA chrIII:205766..205942 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| IV | YDR278C | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
| IV | SUT053/YNCD0033W | New ncRNA chrIV:506334..507774 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| IV | SUT468/YNCD0034C | New ncRNA chrIV:506546..507450 (- strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| VII | SUT532/YNCG0047C | New ncRNA chrVII:17213..17709 (- strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| VII | SUT125/YNCG0048W | New ncRNA chrVII:650855..651159 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158, Feng MW, et al. (2022) PMID:36712349 |
| VII | SUT126/YNCG0049W | New ncRNA chrVII:660087..661399 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| XII | FPS1/YLL043W | New uORF uORF2 3 codons chrXII:49924..49932 (+ strand) ATGCATTAA | Cartwright SP, et al. (2017) PMID:28279185 |
| XIV | ACC1/YNR016C | New uORF 4 codons chrXIV:661704..661715 (- strand) ATGTGTTTATAA | Blank HM, et al. (2017) PMID:28057705 |
| XIV | HOL1/YNR055C | New uORF 7 codons chrXIV:730381..730401 (- strand) ATGCTATTACTACCAAGTTGA | Vindu A, et al. (2021) PMID:34375581 |
| XV | YOL013W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
| XVI | SUT390/YNCP0025W | New ncRNA chrXVI:52977..53465 (+ strand) | Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
| XVI | SUT418/YNCP0026W | New ncRNA chrXVI:588998..589830 (+ strand) | Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
| XVI | YPR108W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
Various sequence and annotation files are available on SGD’s Downloads site.
Categories: Data updates