September 28, 2023
YeastMine is SGD’s data warehouse, powered by InterMine. We have so many templates (i.e., pre-defined queries) that provide access to so many different kinds of data!
A big area of focus for SGD and the yeast community is alleles. Alleles are different versions of genes that vary in DNA and sometimes protein sequence. Did you know that you can easily and quickly get all curated yeast allele data directly from YeastMine?
From the YeastMine home page, click ‘Templates‘ at top left. From there, filter for ‘allele’.

The Genes -> Alleles template returns data for one gene or a list of genes or the entire genome! Data include standard and systematic names for genes, gene name descriptions, allele names and descriptions, allele types, aliases, and references. SGDIDs for genes are included, and now SGDIDs for the alleles have been added. Previously, this query returned all of these data without the SGDIDs for the alleles. Based on user feedback, we have now made these allele SGDIDs available, so that they can be used to identify and distinguish different alleles. Enjoy!

There are thousands of alleles in SGD! Give the YeastMine Genes -> Alleles template a whirl! Get all the alleles for your favorite gene or list of genes.
For help using YeastMine, please see the SGD Help Pages and YouTube Channel.
Categories: Data updates, Website changes
September 20, 2023
Back in the day, SGD maintained an FTP site to distribute data in various files. More recently, you have found these files in the SGD Downloads site. We have now moved these files to YeastMine:

From the YeastMine homepage, click Templates at top left. In the Filter, select ‘Downloads’ to constrain the list of templates.
The following templates are listed under Downloads:
• Deleted Merged Features: Retrieve all deleted and merged features.
• Retrieve Functional Complementation for genes: For gene(s), retrieve information about cross-species functional complementation between yeast and another species.
• Retrieve GO Terms: Retrieve GO Terms, including name, ID, namespace, and definition.
• Retrieve SGD chromosomal Features: Retrieve genes and other chromosomal features, including IDs, coordinates, and descriptions.
• Retrieve all cross-references for all genes: Retrieve IDs for yeast gene and gene products in other databases.
• Retrieve all domains of all genes: Retrieve Proteins/Genes that have a given domain.
• Retrieve all interactions for all genes: Retrieve physical and genetic interactions for all genes.
• Retrieve all pathways for all genes: Retrieve all metabolic pathways for all genes.
• Retrieve protein properties of all proteins of ORFs: Retrieve protein properties, including pI, molecular weight, N-terminal and C-terminal sequences, codon bias, etc. of all proteins.
For help using YeastMine, please see the SGD Help Pages and YouTube Channel.
Categories: Data updates, Tutorial, Website changes
September 14, 2023
SGD curators use the Chemical Entities of Biological Interest (ChEBI) Ontology, maintained by EMBL-EBI, to describe chemicals used in experiments curated from yeast publications and displayed on SGD webpages.
You may have noticed that we have recently added chemical structures provided by ChEBI to the Chemical pages in SGD!

Click the structure to zoom in, click again to zoom back out.

It’s a small detail, but we love this feature, and hope that you do too! Thanks, ChEBI!
Categories: Website changes
Tags: chemicals, phenotypes
September 13, 2023
YeastPathways, which is the database of metabolic pathways and enzymes in the budding yeast Saccharomyces cerevisiae, is manually curated and maintained by the curation team at SGD.
This resource is jam-packed with information, but somewhat hidden from view. To make the pathways more readily accessible, some time ago we added a new section with pathways links on the relevant gene pages. Now the pathways are available in SGD Search!

The category “Biochemical Pathways” is now available, with facets (i.e., subcategories) for References and Loci.

For even easier access, we also added the Pathway names and IDs to the autocomplete in the Search box, to enable quick browsing. Enjoy!

Categories: Website changes
September 08, 2023
The S. cerevisiae strain S288C reference genome annotation was updated. The new genome annotation is release R64.4.1, dated 2023-08-23. Note that the underlying genome sequence itself was not altered in any way.
This annotation update included:
| Chr | Feature | Description of change | Reference |
|---|---|---|---|
| III | SUT035/YNCC0015W | New ncRNA chrIII:205766..205942 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| IV | YDR278C | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
| IV | SUT053/YNCD0033W | New ncRNA chrIV:506334..507774 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| IV | SUT468/YNCD0034C | New ncRNA chrIV:506546..507450 (- strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| VII | SUT532/YNCG0047C | New ncRNA chrVII:17213..17709 (- strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| VII | SUT125/YNCG0048W | New ncRNA chrVII:650855..651159 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158, Feng MW, et al. (2022) PMID:36712349 |
| VII | SUT126/YNCG0049W | New ncRNA chrVII:660087..661399 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| XII | FPS1/YLL043W | New uORF uORF2 3 codons chrXII:49924..49932 (+ strand) ATGCATTAA | Cartwright SP, et al. (2017) PMID:28279185 |
| XIV | ACC1/YNR016C | New uORF 4 codons chrXIV:661704..661715 (- strand) ATGTGTTTATAA | Blank HM, et al. (2017) PMID:28057705 |
| XIV | HOL1/YNR055C | New uORF 7 codons chrXIV:730381..730401 (- strand) ATGCTATTACTACCAAGTTGA | Vindu A, et al. (2021) PMID:34375581 |
| XV | YOL013W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
| XVI | SUT390/YNCP0025W | New ncRNA chrXVI:52977..53465 (+ strand) | Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
| XVI | SUT418/YNCP0026W | New ncRNA chrXVI:588998..589830 (+ strand) | Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
| XVI | YPR108W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
Various sequence and annotation files are available on SGD’s Downloads site.
Categories: Data updates
Tags: genome annotation update, Saccharomyces cerevisiae
August 18, 2023
Homologous recombination is a universal pathway to repair DNA double-stranded breaks, ssDNA gaps, and stalled or collapsed replication forks. Homologous recombination relies on an intact dsDNA donor that is identical to the broken molecule to template the repair event in a copy/paste-type reaction. Typically, this donor is the allelic region on either the sister chromatid or homolog. But what happens when DNA damage falls within, or proximal to, repetitive DNA? A study recently published in Genes and Development by Diedre Reitz and colleagues shows that, in rare cases, homologous recombination can engage two or more repetitive elements in a process termed multi-invasion recombination.

Using genome-wide sequencing, Reitz and colleagues found that multi-invasion recombination can lead to a cascade of recombination-induced rearrangements, aneuploidies, and secondary DNA breaks. By creating a specialized reporter assay, they discovered two pathways in which multi-invasion intermediates can be resolved into products, thereby forming multi-invasion-induced rearrangements. The MIR1 pathway can occur in any sequence context, generates secondary DSBs, and frequently leads to additional genome rearrangements. The MIR2 pathway occurs only when the recombining donors exhibit substantial homology, and results in an insertion without additional DNA breaks. To better understand the molecular determinants of MIR1, the authors developed a highly sensitive proximity ligation-based assay to detect rare MIR1 translocation events. Using this assay, the authors found that, in contrast to normal repair, MIR1 does not require displacement DNA synthesis to fill in the nucleotides lost due to DNA damage.
These vast rearrangements originating from a single DNA break and resolution via the MIR1 pathway are reminiscent of chromothripsis, a mutational signature characterized by large clustered genomic rearrangements frequently associated with certain cancers. Overall, the findings by Reitz and colleagues provide new mechanistic insight into how complex recombination-dependent rearrangements can occur.
— Text from Diedre F. Reitz, with edits and link outs from SGD.
Categories: Research Spotlight
Tags: cancer, homologous recombination
July 18, 2023
Retrovirus-like retrotransposons help shape the genome evolution of their hosts and replicate within cytoplasmic particles. However, how their building blocks associate and assemble within the cell is poorly understood. A new study by Sean Beckwith and coworkers, recently published in PNAS, reports a prion-like domain (PrLD) in the Saccharomyces retrotransposon Ty1 Gag protein.

Gag, also found in retroviruses like HIV, is the structural protein that assembles virus-like particles (VLPs). The PrLD has similar sequence properties to prions and disordered protein domains that can drive the formation of assemblies that range from liquid to solid. The Ty1 PrLD acts like a prion when tested in a cell-based prionogenesis assay, and is essential for transposition (Ty1 doesn’t transpose without it!), but researchers were able to restore transposition by replacing the Ty1 PrLD with similar disordered sequences from yeast SUP35 and mouse PrP prions (how cool is that?!).

These findings from Beckwith et al. uncover a critical function for often overlooked disordered sequences, demonstrate greater flexibility in VLP assembly than previously appreciated, and establish an interchangeable “plug-and-play” platform to study disordered sequences in living cells – all by using the awesome power of yeast genetics (#APOYG!).
— Text from Sean Beckwith, with edits from SGD.
Categories: Research Spotlight
Tags: Saccharomyces cerevisiae, transposon
June 22, 2023
About this newsletter:
This is the Summer 2023 issue of the SGD newsletter. The goal of this newsletter is to inform our users about new features in SGD and to foster communication within the yeast community. You can view this newsletter as well as previous newsletters, on the SGD Community Wiki .

Biochemical pathways have been added to SGD search in order to facilitate easy access to metabolic yeast pathway pages at YeastPathways .
YeastPathways is a database of metabolic pathways and enzymes in the budding yeast Saccharomyces cerevisiae . YeastPathways content is manually curated and maintained by the curation team at SGD, your model organism database for budding yeast. Check it out! 👀 http://yeastgenome.org/search?q=&category=pathway
Manual curation of pathways is an ongoing process at SGD. We welcome feedback from the research community. Please feel free to contact us with any questions or comments.

The May 2023 issue of GENETICS features the second annual collection of Model Organism Database articles.
Scientists from Alliance of Genome Resources member groups SGD , RGD , ZFIN , Gene Ontology , and Xenbase have provided updates on recent activities and innovations.
Be sure to browse the issue and get acquainted with these excellent Knowledgebase and Database Resource papers at GENETICS.

We are proud that SGD has been included in the first list of Global Core Biodata Resources (GCBRs) announced last December by the Global Biodata Coalition (GBC)! This collection of 37 resources comprises deposition databases which archive and preserve primary research data, and knowledgebases, such as SGD, that add value to research data through expert curation and annotation. The list is meant to highlight those data resources whose long term funding and sustainability is critical to life science and biomedical research worldwide.
GCBRs represent the most crucial resources within the global life science data community. SGD’s selection as a key global data resource recognizes that SGD is essential to the global research endeavor.
For more information regarding the Global Biodata Coalition, including a link to the full list of selected core biodata resources, please see the full press release from the GBC.

SGD recently updated our RNA pages to add secondary structures provided by RNAcentral and generated by R2DT .
Thumbnails and linkouts to RNAcentral via RNAcentral IDs are shown on the Summary and Sequence pages. Interactive secondary structure viewers are available on the Sequence pages.
Take the pages for a spin! For more information about the structures, please see the Help page at RNAcentral.

The new website CoSMoS.c. – Conserved Sequence Motif in Saccharomyces cerevisiae – may be of interest to investigators who study protein modifications in budding yeast. The new web-based search algorithm scores conservation of amino acid sequences based on whole-genome sequencing of 1000+ wild and domesticated yeast isolates.
In the recent publication describing the method , Li and Dohlman examined each of the 550 pairs of duplicated genes in S. cerevisiae , integrating 38,000+ documented post-translational modifications (PTMs), and 30,000+ reported interactions between protein kinases and substrates (all obtained from SGD !). More than 3,500 instances were identified where only one of two paralogous proteins undergoes a PTM despite having retained the same amino acid residue in both. Li and Dohlman found that the most common modifications – phosphorylation, ubiquitylation and acylation, but not N-glycosylation – occur in regions of high sequence conservation. The analysis indicates that differences in PTMs may be an important source of protein neo- or sub-functionalization, and that such differences likely account for the retention of closely related enzymes throughout evolution.
You can find links to CoSMoS.c. at the bottom of your favorite protein page at SGD, in the Resources section under Post-translational Modifications.

microPublication Biology is part of the emerging genre of rapidly-published research communications. We are seeing a strong set of microPublications come through the database and are glad for this venue to publish brief, novel findings, negative and/or reproduced results, and results which may initially lack a broader scientific narrative. Each article is peer-reviewed, assigned a DOI, and indexed through PubMed and PubMedCentral.
Consider microPubublications when you have a result that doesn’t necessarily fit into a larger story, but will be of value to others.
Latest yeast microPublications:
All yeast microPublications can be found in SGD .

The Alliance of Genome Resources , a collaborative effort from SGD and other model organism databases (MOD), released version 5.3 last October and version 5.4 this past April.
Version 5.3 saw the addition of Xenopus data from Xenbase. These amphibians are an important tetrapod model, spanning the evolutionary gap between the mammalian (human, mouse, and rat) and zebrafish data already included in the Alliance. Xenopus have long been used in developmental and cell biology, and two species are widely studied. The African clawed frog, X. laevis is an allotetraploid (2n = 36) of hybrid origin. The resulting X. laevis genome has a set of ‘long’ and ‘short’ chromosomes and gene symbols are therefore appended with ‘.L’ or ‘.S’ denoting on which chromosome pair they reside. The second Xenopus species, the Western clawed frog X. tropicalis , is a conventional diploid (2n=20), and is increasingly used in human disease modeling.
Data for both Xenopus species are organized on individual gene pages that feature data such as gene descriptions, orthology to human and other species, disease associations for orthologs, an expression ribbon view, and a Sequence Feature Viewer.
Version 5.4 provides new Alliance SimpleMine and Facebook URLs:
Categories: Newsletter
May 16, 2023
Deadlines for #yeast2023 have been extended! Early bird registration is open until June 5, and abstract submission until July 17. For more information, go to yeastflorence2023.com.


Categories: Conferences
May 08, 2023
The May 2023 issue of GENETICS features the second annual collection of Model Organism Database articles. Scientists from Alliance of Genome Resources member groups SGD, RGD, ZFIN, Gene Ontology, and Xenbase have provided updates on recent activities and innovations. Be sure to browse the issue and get acquainted with these excellent Knowledgebase and Database Resource papers at GENETICS. Cover art by Vivid Biology.

Categories: Announcements
Tags: Saccharomyces cerevisiae, yeast